dig labeled lna probes  (Kaneka Corp)

Journal: Nature cancer

Article Title: Two isoleucyl tRNAs that decode ‘synonymous’ codons divergently regulate breast cancer progression

doi: 10.1038/s43018-022-00469-9

Figure Lengend Snippet: (a) Volcano plot representing log2 fold change vs. −log p value of POL3RA ChIP sequencing analysis of MDA-LM2 cells vs. MDA-MB-231 Parental cells. (b) tRNAIleUAU quantification by specific tRNAIleUAU probe RT-qPCR normalized to 18S probes of highly metastatic LM2 lines relative to their parental MDA-MB-231 and HCC1806 cell lines. (c) tRNAIleGAU quantification by specific tRNAIleGAU probe RT-qPCR normalized to 18S probes of highly metastatic LM2 lines relative to the parental MDA-MB-231 cell line. (d,e) Relative pre-tRNA abundance of tRNAIleUAU and tRNAIleGAU across multiple primers covering distinct genetic loci using RT-qPCR of MDA-LM2 vs. MDA-MB-231 (d) & HCC1806-LM2C vs. HCC1806 Parental cells (e). (f) Relative tRNAIleUAU/tRNAIleGAU ratios quantified by fluorescent intensity normalized to DAPI of breast tissue microarrays, stratified by normal tissue or breast cancer stage I & II, III, measured by FISH with LNA targeting tRNAIleUAU or tRNAIleGAU. Two-sided un-paired student’s t-tests performed, p-values p<0.05, p<0.01, p<0.001 represented as *, **, ***, respectively.

Article Snippet: 40 nM tRNA double DIG labeled LNA Probe targeting tRNA Ile UAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNA Ile GAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute.

Techniques: ChIP-sequencing, Quantitative RT-PCR

Journal: International Journal of Oral Science

Article Title: A novel saliva-based miRNA profile to diagnose and predict oral cancer

doi: 10.1038/s41368-023-00273-w

Figure Lengend Snippet: Boxplots illustrating the expression levels of miRNAs in tissue samples. It is evident that miR-7-5p, miR-182-5p, miR-431-5p and miR-486-3p exhibit significant expression changes between tumour tissue ( n = 6) and healthy tissue ( n = 5)

Article Snippet: Proteinase K was purchased from Qiagen, MD, USA. hsa-miR-7-5p miRCURY LNA miRNA Detection probe (double DIG (Digoxigenin) labelled) (Qiagen) or negative control miRNA scrambled probe (double DIG labelled) (Integrated DNA Technologies) or u6 snRNA positive control probe (double DIG labelled) were used at 100 nmol/L per slide.

Techniques: Expressing

Journal: International Journal of Oral Science

Article Title: A novel saliva-based miRNA profile to diagnose and predict oral cancer

doi: 10.1038/s41368-023-00273-w

Figure Lengend Snippet: Localisation of miR-7-5p in FFPE tissue samples using miRNA in situ hybridisation. a1 H&E-stained Adjacent Normal Region of the test sample (x60), a2 Overview of H&E-stained section of the test sample (x10), a3 H&E-stained tumour region of test sample (x60). b1 miRNA in situ hybridisation of Adjacent Normal Region of the test sample (x60), b2 Overview of miRNA in situ hybridisation of test sample (x10), b3 miRNA in situ hybridisation of Tumour Region of Test sample (x60). It is evident that the tumour region exhibits stronger staining compared to the adjacent normal region, demonstrating the overexpression of miR-7-5p in the tumour region. c Negative control stained with DIG-labelled scrambled miRNA probe (x10). d Positive control using DIG-labelled U6 snRNA probe (x10)

Article Snippet: Proteinase K was purchased from Qiagen, MD, USA. hsa-miR-7-5p miRCURY LNA miRNA Detection probe (double DIG (Digoxigenin) labelled) (Qiagen) or negative control miRNA scrambled probe (double DIG labelled) (Integrated DNA Technologies) or u6 snRNA positive control probe (double DIG labelled) were used at 100 nmol/L per slide.

Techniques: In Situ, Hybridization, Staining, Over Expression, Negative Control, Positive Control

Journal: International Journal of Oral Science

Article Title: A novel saliva-based miRNA profile to diagnose and predict oral cancer

doi: 10.1038/s41368-023-00273-w

Figure Lengend Snippet: The discriminative performance of salivary miR-7-5p in the validation phase. a Oral cancer vs. Healthy controls, b oral cancer vs. oral potentially malignant disorders. The AUC value is calculated using receiver operating characteristic analysis

Article Snippet: Proteinase K was purchased from Qiagen, MD, USA. hsa-miR-7-5p miRCURY LNA miRNA Detection probe (double DIG (Digoxigenin) labelled) (Qiagen) or negative control miRNA scrambled probe (double DIG labelled) (Integrated DNA Technologies) or u6 snRNA positive control probe (double DIG labelled) were used at 100 nmol/L per slide.

Techniques: